circad | circRNAs associated with diseases

hsa_circ_0001564
Gene	CANX	Organism	Human
Genome Locus	chr5:179132679-179137066:+	Build	hg19
Disease	Osteosarcoma	ICD-10	Malignant neoplasm of bone and articular cartilage of other and unspecified sites (C41)
DBLink	Link to database	PMID	29229385
Experimental Method
Sample Type	Tissues	Comparison	Human primary osteosarcoma samples (n=11) and their paired adjacent noncancerous tissue samples
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CATCCTTTGCGCTCAGAGGA Reverse GATTGGCCTGACCACAGTCTA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Song, YZ, Li, JF (2018). Circular RNA hsa_circ_0001564 regulates osteosarcoma proliferation and apoptosis by acting miRNA sponge. Biochem. Biophys. Res. Commun., 495, 3:2369-2375.